Ancestros comunes

De la colaboración entre ciencias surgen descubrimientos inesperados

 

Los “bordes” que supuestamente definen cada ciencia son cada vez más borrosos. El hombre requiere de todas las herramientas que tiene a su alcance, razón por la cual ciertas etiquetas tienen cada vez menos sentido. En lugar de decir: “Este es un problema para un físico o para un ingeniero o un arquitecto o un biólogo o un matemático” (etc), uno debería decir: «Tengo este problema. ¿Cómo lo resolvemos? Pensemos juntos». Como consecuencia, el avance llega solo. O más fácil.

El texto que sigue muestra cómo los vasos comunicantes que generaron biólogos y matemáticos que trabajan en la frontera del conocimiento permitieron poner en evidencia (una vez más) la existencia de ancestros comunes.

Durante el año 2005, en una charla que manteníamos en un café de la facultad de Exactas (UBA) con Alicia Dickenstein (matemática y una de mis mejores amigas, una persona que claramente tuvo una incidencia muy positiva en mi vida), ella me comentó acerca de un trabajo muy interesante que involucró a biólogos y matemáticos.

Más precisamente, me contó el resumen del trabajo The Mathematics of Phylogenomics, escrito por Lior Pachter y Bernd Sturmfels, del Departamento de Matemática de UC Berkeley, cuya versión preliminar fue publicada el 8 de septiembre del 2004 en http://arxiv.org/pdf/math.ST/0409132. Una versión revisada se publicó en el mismo sitio el 27 de septiembre del 2005 y el artículo apareció definitivamente editado en la importante SIAM Review, editada por la Society for Industrial and Applied Mathematics. Desde el momento en que en el año 2003 se completó el Proyecto Genoma Humano (HGP de acuerdo con su sigla en inglés, Human Genome Project), comenzó la carrera también por conocer e identificar a nuestros antepasados, y saber con quiénes compartimos ese “privilegio”.

El proyecto, que duró más de 13 años, permitió identificar los (aproximadamente) entre 20.000 y 25.000 genes del genoma humano, y determinar las secuencias de los tres mil millones de pares de bases químicas que lo componen.

Es decir, es como si uno tuviera un alfabeto que consiste en nada más que cuatro letras: A, T, C y G.

Estas son las iniciales de:

A = Adenina

T = Timina

C = Citosina

G = Guanina

El ADN de una persona es algo así como su cédula de identidad. Allí está escrita toda la información necesaria para el funcionamiento de sus células y sus órganos. En esencia, en una molécula de ADN está inscripto todo lo que podemos ser, nuestras particulares aptitudes y capacidades, y algunas de las enfermedades que podemos padecer. No obstante, es la combinación de esa información con el aporte del ambiente lo que hace que cada uno de nosotros sea único.

Esa hélice doble de la que hablaba es como si fuera una serpentina que tiene escritas dos tiras enfrentadas de largas cadenas de esas cuatro letras. Pero, además, tiene una particularidad: si en una de las tiras en un lugar hay una letra A, entonces en el lugar correspondiente de la otra tiene que haber una letra T, y si hay una C, entonces en la otra tiene que haber una G. En otra palabras, vienen apareadas. (De hecho, para recordar esta particularidad los tangueros usan las iniciales de Aníbal Troilo y Carlos Gardel.)

Ahora bien, ¿a qué viene todo esto que parece más asociado a un artículo sobre biología molecular que a algo que tenga que ver con la matemática? Me falta sólo un paso.

En el artículo de Lior Pachter y Bernd Sturmfels, y también en el libro Algebraic Statistics for Computational Biology, Cambridge University Press, 2005, los autores estudiaron una situación muy particular.

Mire esta porción de ADN:

TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG

Son 42 letras, en el orden en el que están escritas. Para decirlo de otra forma, sería como una palabra de 42 letras.

Esta “tira” del genoma fue encontrada (después de un arduo trabajo matemático y computacional de “alineación” de las distintas secuencias) en algún lugar del ADN de los siguientes vertebrados: hombre, chimpancé, ratón, rata, perro, pollo, rana, peces…

Si uno tirara un dado que, en lugar de las seis caras convencionales, tuviera sólo cuatro lados rotulados A, C, G, T, la probabilidad estimada de que esta secuencia de 42 letras apareciera en ese orden es de uno dividido 1050.

Es decir, la probabilidad de que esto haya ocurrido por azar es aproximadamente igual a:

10-50 = 0,00000…0001

Para decirlo de otra forma, el número empezaría con un cero, y luego de la coma, cuarenta y nueve ceros y recién un número uno.

Justamente, la probabilidad de que esto ocurra es tan baja que permite a los autores del artículo conjeturar que todos ellos tuvieron un antepasado o un ancestro común (probablemente hace unos 500 millones de años), el cual ya poseía esa secuencia de 42 bases, la que fue heredada intacta a todos los descendientes de las distintas ramas de vertebrados.

Y por lo tanto, si bien uno no puede hablar de certeza, la probabilidad de que el hombre, usted, yo, tengamos el mismo origen que un pollo o un perro o un ratón (ni hablar un chimpancé), es altísima.

 

 

 

El prestigioso científico argentino Alberto Kornblihtt, biólogo molecular y uno de los investigadores de prestigio mundial que tiene el país, revisó el texto y lo mejoró. Los aciertos son de él. Los potenciales errores corren por mi cuenta.

 

 

 

--------------------------------

Para suscribirte con $ 250/mes al Cohete hace click aquí

Para suscribirte con $ 500/mes al Cohete hace click aquí

Para suscribirte con $ 1000/mes al Cohete hace click aquí

4 Comentarios
  1. AnaC dice

    Maravillosa genética, Adrián! Watson era biólogo y tenía 20 años; Crick era físico y tenía 33 años cuando descifraron la estructura doble y complementaria del ADN., como si fuese una larguísima escalera caracol (cada escalón formado por dos «letras») A veces pienso que un músico podría hacer la analogía de la secuencia de «letras» como secuencia de acordes de «notas musicales»; y así veríamos cuántas melodías en común tenemos con los vertebrados. Y, según Sagan, con las bacterias, al descomponer la glucosa de una manzana (él, en realidad, lo decía comparando la «biblioteca genética» repetitiva e inmutable con la «biblioteca intelectual» de muchísimos más libros actualizables permanentemente, intercalando páginas)

  2. Pablo dice

    Muy bueno, muestra el trabajo en equipo y gran descubrimiento.

  3. Pablo dice

    Muy bueno, muestra el trabajo en equipo y gran descubrimiento

  4. Nicolás Scardetta dice

    El placer de encontrar a Paenza es tan grande como la ilusión de que «El Cohete» pueda sumar las 3 o 4 firmas que uno necesita para no abrir otro medio. Sé que es difícil.

Dejá tu comentario

Su dirección de correo electrónico no será publicada.